Skip to content

Główna rola VCAM-1, ale nie ICAM-1, we wczesnej miażdżycy ad

2 miesiące ago

694 words

Alternatywne składanie RNA wytwarza izoformy VCAM-1 z jednym lub dwoma miejscami wiążącymi integrynę a4 (pełne kółka). Pętle, domeny Ig połączone wiązaniami disulfidowymi 1. 7. Groty strzał, skrzyżowania eksonów. (b) mysi gen Vcam1 typu dzikiego, konstrukt targetujący D4D i rekombinacja homologiczna w locus Vcam1. D4 (ekson 6) został przerwany przez celowanie genowe. Czarne skrzynki, eksony 1. 10. Domeny D1-D7, Ig. PI, domena zapewniająca połączenie fosfatydyloinozytolu z 3 Ig VCAM-1. Wskazano miejsca enzymu restrykcyjnego i sondę Southern blot. (c) Analiza Southern biot strawionego BamHI genomowego DNA z potomstwa heterozygotycznego krycia. Linia ciągła powyżej pasów wskazuje każdy miot. Wszystkie allele Vcam1 + i Vcam1D4D mają odpowiednio 12 i 8 kb. Genotypowanie. Myszy genotypowano metodą Southern blotting (Figura 1, b i c) lub PCR. DNA wyizolowano z biopsji ogonowych (18) z lub bez (do PCR) wytrącania izopropanolem. Produkty PCR miały 300 i 500 bp dla alleli Vcam1 + i Vcam1D4D. Użyto wspólnego startera przedniego (5 (3 -ATACATTGGGTATGGTGTGATATG), który wiąże się z 3. koniec eksonu 5 [domena przyłączona przez fosfatydyloinozytol (PI)]. Primer odwrotny allelu typu dzikiego (5a-AACTTAAAATCCATGTTTTCATAGG) rozpoznał intron zastąpiony przez NEO w zmutowanym allelu. Zmutowany starter odwrotny allelu (5a -CAAGCAAAACCAAATTAAGGG) rozpoznał 3. nieulegający translacji region kinazy fosfoglicerydowej-1 w NEO. Warunki PCR były następujące: (94 ° C / 90 s, 56 ° C / 60 s, 72 ° C / 120 s) × 3, (94 ° C / 30 s, 56 ° C / 30 s, 72 ° C / 60 s) × 27 i 72 ° C / 7 min. Cytometrii przepływowej. Heparynizowaną krew uzyskano od myszy przez nakłucie serca i 50 ul inkubowano z 50 ul PBS zawierającym blok Fc (anty-mysie CD16 / CD32) i szczurzą IgG przez 20 minut w temperaturze 22 ° C. Pierwotne przeciwciała (szczurzy monoklonalne) inkubowano przez 30 minut w 22 ° C. Obejmowały sprzężone z biotyną anty-CD19, skoniugowane z fluoresceiną anty-CD3, skoniugowane z fluoresceiną anty-GR1 i skoniugowane z fikoerytryną anty-CD11b (BD PharMingen, San Diego, Kalifornia, USA). Komórki przemyto PBS zawierającym 2,5% FBS i inkubowano z fluorochromem streptawidyny, jeśli było to wymagane (4 ° C przez 30 minut), a erytrocyty usunięto za pomocą hipotonicznej lizy. Cytometria przepływowa została przeprowadzona natychmiast po ostatnim płukaniu za pomocą cytometru przepływowego Epics XL-MCL (Coulter Corp., Miami, Floryda, USA). Northern blotting. Całkowity RNA (10 .g) wydzielony przez ultrawirowanie przez gradient chlorku cezu lub mRNA (3 .g) oczyszczony z użyciem celulozy oligo-dT analizowano metodą Northern blotting (19). RT-PCR. RT (zestaw SuperScript, Life Technologies Inc., Rockville, Maryland, USA) dla alternatywnie złożonego 7 i 6 Ig VCAM-1 użył startera komplementarnego do GATTGAATTACTGAAGG w D5. Dla 3 Ig VCAM-1 primer RT był komplementarny do CATCATTTGCATGGGGTCA w domenie PI. Reakcje PCR [(94 ° C / s, 92 ° C / 29 s, 50 ° C / 30 s, 72 ° C / 60 s) × 35] wykorzystały wspólny starter przedni CAATGACCTGTTCCAGCGAG z D3 i swoiste dla domeny primery odwrotne komplementarne do CCAAATCCACGCTTGTGTT (w D4), CAAGCATTCCCTGAAGATCC (obejmującego połączenie D3. D5) i CTTGCTCTGTGAGGAAGCTG (w domenie PI). Produkty 382, 217 i 319 bp dla odpowiednio 7, 6 i 3 Ig VCAM-1 rozdzielono na 1,5% żelach agarozowych. Immunoprecypitacja i immunohistochemia. Izolowane enzymatycznie komórki płuc (20) pozbawiono makrofagów za pomocą magnetycznych kulek anty-Fc receptora. W tym celu szczurze przeciwciała monoklonalne wobec mysiego Fc. Receptory III i II (CD16 i CD32) (PharMingen, San Diego, Kalifornia, USA) związano z kulkami magnetycznymi M-450 sprzężonymi z owczymi przeciwciałami anty-szczurzymi IgG (Dynal Biotech Inc., Lake Success, New York, USA). Komórki z subkultury 2 traktowano mediami lub mysimi TNF-a. (20 ng / ml) przez 4 godziny, a białka powierzchni komórkowej biotynylowano (21). Białka VCAM-1 i ICAM-1 ilościowo immunoprecypitowano z oczyszczonych przez wirowanie pełnych lizatów Triton X-100 przy użyciu odpowiednio przeciwciał monoklonalnych (szczurzy IgGl) MK-2 i YN1.1 oraz koziej anty-szczurzo-IgG-sefarozy. Po SDS-PAGE i przeniesieniu do membran z difluorkiem poliwinylidenu, biotynylowane białka powierzchniowe komórki wizualizowano stosując sprzężoną z peroksydazą streptawidynę i emisję chemiluminescencyjną (Amersham Pharmacia Biotech Ltd., Piscataway, New Jersey, USA) i oznaczono ilościowo stosując analizę molekularną (Sunnyvale, Kalifornia). , USA) densytometr. Barwienie immunoperoksydazą skrawków wyciętych z kriostatu (15) wykorzystywało MK-2 i YN1.1, przy czym immunoglobuliną IgG nie immunizowano jako kontrolę negatywną. Badania miażdżycowe. Vcam1D4D / D4D i Ldlr. /. (22) myszy hodowano, a ich potomstwo hodowano z powrotem do Ldlr. /. uzyskać Vcam1 + / D4DLdlr. /. myszy. Zostały one skrzyżowane w celu uzyskania eksperymentów z dobranymi płciowo parami z miotu (Vcam1 + / + Ldlr <3 i Vcam1D4D / D4DLdlr